Skip to main content

Table 1 Sequence of the primers used to perform the PCR for the different fragments of ataxin-2 and GAPDH as loading control

From: New alternative splicing variants of the ATXN2 transcript

RT-PCR Primer name Sequence 5’to 3´ Length (bp)
A A-Forward TGGGCAGAGGTCGAAACAGTAACA 24
A-Reverse TGCATCCCAGGGCTCCAGGTC 21
B B-Forward AATGTTCAGACTTTGTTGTGGTA 23
B-Reverse TCGGGTTGAAATCTGAAGTGTGAG 24
C C-Forward TGAGGGGCACAGCATAAACACT 22
C-Reverse CGTAGGAGATGCAGCTGGAATAGG 24
D D-Forward GGGGGAACGTGGTCATCAGTGGT 23
D-Reverse GGTTGCACGCCTGGGCTC 18
E E-Forward TCAGCCAAAGCCTTCTACTACCC 23
E-Reverse CATGTTGGCTTTGCTGCTGTC 21
F F-Forward CCCAAATTACCATACAACAAGGAG 24
F-Reverse GATGTGTTCATGACTTTCAAGG 22
GAPDH Forward TTCACCACCATGGAGAAGGC 20
Reverse GGCATCGACTGTGGTCATGA 20